Journal:

Article Title: Human TMEM30a Promotes Uptake of Anti-tumor and Bioactive Choline Phospholipids into Mammalian Cells 1

doi: 10.4049/jimmunol.1002710

Figure Lengend Snippet: Human TMEM30a partially reconstitutes phospholipid import in ⊗Lem3 S. cerevisiae

Article Snippet: Human TMEM30a cDNA was purchased from Origene Technologies (Rockville, MD), and shRNA plasmids against human TMEM30a were from SuperArray Bioscience (Frederick, MD).

Techniques:

Journal:

Article Title: Human TMEM30a Promotes Uptake of Anti-tumor and Bioactive Choline Phospholipids into Mammalian Cells 1

doi: 10.4049/jimmunol.1002710

Figure Lengend Snippet: (A) ΔLem3 S. cerevisiae transformed with empty vector or two isolates transformed with human TMEM30a were grown on glucose or galactose to induce TMEM30a expression. NBD-phosphatidylcholine uptake was determined by flow cytometry. (B) Concentration dependent effect of Edelfosine on colony growth of serially diluted wild-type S. cerevisiae or ΔLem3 transformed with empty vector or two ΔLem3 isolates transformed with human TMEM30a.

Article Snippet: Human TMEM30a cDNA was purchased from Origene Technologies (Rockville, MD), and shRNA plasmids against human TMEM30a were from SuperArray Bioscience (Frederick, MD).

Techniques: Transformation Assay, Plasmid Preparation, Expressing, Flow Cytometry, Concentration Assay

Journal:

Article Title: Human TMEM30a Promotes Uptake of Anti-tumor and Bioactive Choline Phospholipids into Mammalian Cells 1

doi: 10.4049/jimmunol.1002710

Figure Lengend Snippet: (A) NBD-phosphatidylcholine uptake determined by flow cytometry for wild-type S. cerevisiae transformed with empty vector or ΔLem3 transformed with Lem3, TMEM30a or a chimera (Table 1) of Lem3 and TMEM30a. (B) Quantitation (n=3) of NBD-phosphatidylcholine uptake by ΔLem3 transformed with Lem3-TMEM30a (LT; see Table 1 for sequence), TMEM30a-Lem3 (TL), or TMEM30a-Lem3-TMEM30a (TLT) chimeras. Western blot (top) for V5 antigen contained in sequences encoding TMEM30a and its chimeras isolated from protein extracts of S. cerevisiae grown in galactose to induce insert expression or non-inducing glucose. (C) Concentration dependent effect of Edelfosine on colony formation on glucose or galactose plates for wild-type S. cerevisiae or ΔLem3 transformed with galactose induced human, yeast or chimeric constructs. (D) Effect of Edelfosine on ΔLem3 viability after introduction of human TMEM30a, yeast Lem3p, or chimeras formed from them. Cell number (OD600) in liquid culture of wildtype or ΔLem3 transformed with the stated vectors at defined concentrations (left) or 12.5 μg/ml (right).

Article Snippet: Human TMEM30a cDNA was purchased from Origene Technologies (Rockville, MD), and shRNA plasmids against human TMEM30a were from SuperArray Bioscience (Frederick, MD).

Techniques: Flow Cytometry, Transformation Assay, Plasmid Preparation, Quantitation Assay, Sequencing, Western Blot, Isolation, Expressing, Concentration Assay, Construct

Journal:

Article Title: Human TMEM30a Promotes Uptake of Anti-tumor and Bioactive Choline Phospholipids into Mammalian Cells 1

doi: 10.4049/jimmunol.1002710

Figure Lengend Snippet: (A) CHO cells stably transfected with TMEM30a-GFP and then stained with CellMask™ Orange Plasma Membrane to mark the plasma membrane (top) then imaged by confocal microscopy. Co-expression of the appropriate orange fluorescent protein Organelle Light defined endoplasmic reticulum (row 2), or Golgi (row 3). TMEM30a-GFP expressing CHO cells were labeled with MitoTracker Red to identify polarized mitochondria (bottom). (B) Western blot for GFP or plasma membrane Na/K ATPase in density gradient fractions from HepG2 cells stably expressing TMEM30a-GFP. (C) Fluorescent intensity of TMEM30a-Jurkat cells during flow cytometry after 10 min incubation in the presence of NBD-phosphatidylcholine (1 μM) alone or additionally with 5 μM Az-LPAF or Edelfosine.

Article Snippet: Human TMEM30a cDNA was purchased from Origene Technologies (Rockville, MD), and shRNA plasmids against human TMEM30a were from SuperArray Bioscience (Frederick, MD).

Techniques: Stable Transfection, Transfection, Staining, Confocal Microscopy, Expressing, Labeling, Western Blot, Flow Cytometry, Incubation

Journal:

Article Title: Human TMEM30a Promotes Uptake of Anti-tumor and Bioactive Choline Phospholipids into Mammalian Cells 1

doi: 10.4049/jimmunol.1002710

Figure Lengend Snippet: (A) NBD-phosphatidylcholine uptake by CHO cells transfected with empty vector or a TMEM30a vector assessed by confocal microscopy (40X). Inset, 60X. (B) Uptake of [3H]PAF by CHO cells expressing TMEM30a containing a GFP or Lumio tag (n=3). (C) Phosphatidylserine surface expression is not reduced in TMEM30a transfected CHO cells. Surface phosphatidylserine was detected (n=3) by flow cytometry with annexin V conjugated with Alexa647 as described in “Methods.”

Article Snippet: Human TMEM30a cDNA was purchased from Origene Technologies (Rockville, MD), and shRNA plasmids against human TMEM30a were from SuperArray Bioscience (Frederick, MD).

Techniques: Transfection, Plasmid Preparation, Confocal Microscopy, Expressing, Flow Cytometry

Journal:

Article Title: Human TMEM30a Promotes Uptake of Anti-tumor and Bioactive Choline Phospholipids into Mammalian Cells 1

doi: 10.4049/jimmunol.1002710

Figure Lengend Snippet: (A) Quantitative PCR for TMEM30a mRNA after transfection by empty vector or one containing TMEM30a shRNA (n=3). (B) Jurkat viability to Edelfosine exposure after transfection with an empty vector or TMEM30a shRNA (n=3). (C) Jurkat cell uptake of fluorescent NBD-phosphatidylcholine (upper) or NBD-phosphatidylethanolamine (lower) by cells expressing TMEM30a shRNA or its vector (n=3). (D) Quantitation of NBD-phosphatidylcholine accumulation by Jurkat cells expressing TMEM30a shRNA or empty vector (n=3). (E) Uptake of [3H]PAF by Jurkat cells is reduced by TMEM30a shRNA knockdown (n=4). All quantitative measures used triplicate determinations in each experiment.

Article Snippet: Human TMEM30a cDNA was purchased from Origene Technologies (Rockville, MD), and shRNA plasmids against human TMEM30a were from SuperArray Bioscience (Frederick, MD).

Techniques: Real-time Polymerase Chain Reaction, Transfection, Plasmid Preparation, shRNA, Expressing, Quantitation Assay

Journal:

Article Title: Human TMEM30a Promotes Uptake of Anti-tumor and Bioactive Choline Phospholipids into Mammalian Cells 1

doi: 10.4049/jimmunol.1002710

Figure Lengend Snippet: (A) Flow cytometric analysis of JC-1 green fluorescence (FL1, x axis) and orange/red fluorescence (FL2, y axis) in the presence of the stated azelaoyl lysoPAF concentration in vector and TMEM30a shRNA transfected Jurkat cells. The cationic dye JC1 in functional, polarized mitochondria is aggregated and fluoresces red/orange, while monomeric dye free in the cytoplasm fluoresces green. (B) Flow cytometric analysis of JC-1 fluorescence in the stated concentration of Edelfosine.

Article Snippet: Human TMEM30a cDNA was purchased from Origene Technologies (Rockville, MD), and shRNA plasmids against human TMEM30a were from SuperArray Bioscience (Frederick, MD).

Techniques: Fluorescence, Concentration Assay, Plasmid Preparation, shRNA, Transfection, Functional Assay

Journal: Frontiers in Molecular Biosciences

Article Title: A systematic review of the barcoding strategy that contributes to COVID-19 diagnostics at a population level

doi: 10.3389/fmolb.2023.1141534

Figure Lengend Snippet: Schematic representation of mechanistic strategies of barcoding. (A–C) Barcodes can be introduced to a template using adaptors through direct ligation (A) , using RT- or PCR primers at the reverse transcription or PCR amplification step (B) , and using hybridizing molecular inversion probes (C) . (D) Schematic representation of the difference between “barcodes” and “sample indexes”. Barcodes aim to correct sequencing errors. For example, a misreading nucleotide, guanosine (G) can be corrected in final consensus sequences for a pool of Sample 1 (top panel). Sample indexes are used to multiplex different sequencing amplicons generated from different pools of samples (Sample 1, 2, and 3) (bottom panel). Panel (A) is modified based on in and panel (C) is modified based on in .

Article Snippet: Primer-associated approach , Sequence-based barcodes , SQK-RBK004: transposase carrying barcodes to the site of the cleavage , - , - , Whole genome , Oxford Nanopore Rapid Barcoding kit (SQK-RBK004) , SARS-CoV-2 patient samples (nasopharyngeal swab) , Oxford Nanopore , Guppy version 3.6.0; ARTIC Network bioinformatics protocol , Multiplex samples , Propose a method to sequence the whole genome of SARS-CoV-2 in a rapid and cost-efficient manner , .

Techniques: Ligation, Reverse Transcription, Amplification, Sequencing, Multiplex Assay, Generated, Modification

Journal: Frontiers in Molecular Biosciences

Article Title: A systematic review of the barcoding strategy that contributes to COVID-19 diagnostics at a population level

doi: 10.3389/fmolb.2023.1141534

Figure Lengend Snippet: Systematic comparison of barcoding strategies used in the category of molecular barcodes.

Article Snippet: Primer-associated approach , Sequence-based barcodes , SQK-RBK004: transposase carrying barcodes to the site of the cleavage , - , - , Whole genome , Oxford Nanopore Rapid Barcoding kit (SQK-RBK004) , SARS-CoV-2 patient samples (nasopharyngeal swab) , Oxford Nanopore , Guppy version 3.6.0; ARTIC Network bioinformatics protocol , Multiplex samples , Propose a method to sequence the whole genome of SARS-CoV-2 in a rapid and cost-efficient manner , .

Techniques: Comparison, Software, Sequencing, Multiplex Assay, CRISPR, Plasmid Preparation, Microarray, Binding Assay, Amplification, Extraction, Ligation, DNA Sequencing, Multiplexing, Generated, Reverse Transcription, Staining, Flow Cytometry, High Throughput Screening Assay, Inhibition, Blocking Assay, Conjugation Assay, RNA Sequencing Assay, Transmission Assay, Incubation, Diagnostic Assay, Next-Generation Sequencing, Infection

Journal: Genome Biology

Article Title: RNA methylomes reveal the m 6 A-mediated regulation of DNA demethylase gene SlDML2 in tomato fruit ripening

doi: 10.1186/s13059-019-1771-7

Figure Lengend Snippet: Dynamics of DNA methylation (5mC) and mRNA m 6 A methylation in tomato fruit ripening. a Images of wild-type (WT) fruit at different ripening stages and Cnr fruit at 42 DPA. DPA, days post-anthesis; scale bar = 1 cm. b Relative 5mC levels of WT and Cnr fruit shown in a . For 5mC assay, 100 ng of genomic DNA was detected in each sample by MethylFlash™ methylated DNA quantification kit. 5mC level in each sample was normalized to that of the positive control according to the manufacturer’s instructions. The plus sign represents the average in each box. c LC-MS/MS assay showing the amount of mRNA m 6 A in WT and Cnr fruit shown in a . Data are presented as mean ± standard deviation ( n = 3). Asterisks indicate significant differences (* P < 0.05, ** P < 0.01; Student’s t test). NS, no significance

Article Snippet: In brief, genomic DNA was extracted from the agroinfiltrated N. benthamiana leaves, and 500 ng of purified DNA was treated with bisulfite to produce mutations from cytosine (C) to thymine (T) using EZ DNA methylation-gold kit (ZYMO Research, D5005).

Techniques: DNA Methylation Assay, Methylation, Positive Control, Liquid Chromatography with Mass Spectroscopy, Standard Deviation

Journal: Genome Biology

Article Title: RNA methylomes reveal the m 6 A-mediated regulation of DNA demethylase gene SlDML2 in tomato fruit ripening

doi: 10.1186/s13059-019-1771-7

Figure Lengend Snippet: SlALKBH2 is transcriptionally regulated by DNA methylation. a The 5mC levels in the differentially methylated region (DMR) of SlALKBH2 promoter in wild-type (WT) and Cnr mutant fruit based on the Tomato Epigenome Database ( http://ted.bti.cornell.edu/epigenome/ ). b The 5mC levels in the DMR of SlALKBH2 promoter in WT and sldml2 mutant fruit based on the DNA methylome database . a , b The numbers indicate the cytosine positions relative to the start codon. Black represents the methylation frequency of cytosines at the indicated positions. DPA, days post-anthesis. c Schematic of the dual-luciferase system used for promoter activity assay. The SlALKBH2 promoter was cloned into the dual-luciferase reporter vector to activate the expression of firefly luciferase (Fluc). The renilla luciferase (Rluc) driven by the CaMV 35S promoter served as an internal control. LB, left border; RB, right border; Ter, terminator. d – f Co-expression of SlDML2 (SlDML2-HA) with the dual-luciferase reporter vector in the Nicotiana benthamiana leaves increased the relative Fluc activity ( d ), facilitated the Fluc gene expression ( e ), and reduced the 5mC level in SlALKBH2 promoter ( f ) compared with the empty plasmid control (HA). d The representative image from a total of six images (left panel). The Fluc activity was normalized against the Rluc activity, followed by normalization against the control (right panel). Data are presented as means ± standard deviation ( n = 6). Asterisks indicate significant differences (*** P < 0.0001; Student’s t test). e Gene expression was determined by quantitative RT-PCR analysis. Error bars represent the standard deviation of three independent experiments. Asterisks indicate significant differences (* P < 0.05; Student’s t test). f The box plot showing 5mC levels of all cytosines ( n = 41) in the DMR analyzed by Sanger bisulfite sequencing. The plus sign represents the average level in each box

Article Snippet: In brief, genomic DNA was extracted from the agroinfiltrated N. benthamiana leaves, and 500 ng of purified DNA was treated with bisulfite to produce mutations from cytosine (C) to thymine (T) using EZ DNA methylation-gold kit (ZYMO Research, D5005).

Techniques: DNA Methylation Assay, Methylation, Mutagenesis, Luciferase, Activity Assay, Clone Assay, Plasmid Preparation, Expressing, Standard Deviation, Quantitative RT-PCR, Methylation Sequencing

Journal: Genome Biology

Article Title: RNA methylomes reveal the m 6 A-mediated regulation of DNA demethylase gene SlDML2 in tomato fruit ripening

doi: 10.1186/s13059-019-1771-7

Figure Lengend Snippet: SlALKBH2 is necessary for normal tomato fruit ripening. a Genotyping of mutations mediated by CRISPR/Cas9 gene-editing system in slalkbh2-23 , slalkbh2-25 , and slalkbh2-28 mutants. Diagram showing the single guide RNAs (sgRNAs) containing different target sequences (T1, T2, and T3), which were designed to specifically target the exons of SlALKBH2 . The red letters indicate the protospacer adjacent motif (PAM). The transgenic plants in the second generation were genotyped by sequencing genomic regions flanking the target sites. Red arrows indicate the editing sites. Two mutants ( slalkbh2-23 and slalkbh2-28 ) have a homozygous 1-bp insertion, and one ( slalkbh2-25 ) has a homozygous 5-bp deletion caused by target T2 in the fourth exon of SlALKBH2 . b Ripening phenotype of slalkbh2 mutants. Fruit from wild-type (WT) and slalkbh2 mutants ( slalkbh2-23 , slalkbh2-25 , and slalkbh2-28 ) at 39, 42, 47, and 52 days post-anthesis (DPA) are shown. c LC-MS/MS assay showing the amount of mRNA m 6 A in WT and slalkbh2 mutant fruit at 39 DPA. Data are presented as mean ± standard deviation ( n = 3). d m 6 A-IP-PCR assay showing the relative m 6 A enrichment in SlDML2 mRNA in WT and slalkbh2 mutant fruit at 39 DPA. e SlDML2 gene expression in WT and slalkbh2 mutant fruit at 39 and 42 DPA. The ACTIN gene was used as an internal control. d , e Error bars represent the standard deviation of three independent experiments. Asterisks indicate significant differences (* P < 0.05, ** P < 0.01; Student’s t test). f Model for the relationship between DNA methylation and m 6 A mRNA methylation in fruit ripening. DNA methylation negatively regulates SlALKBH2 to mediate overall m 6 A mRNA methylation. The m 6 A modification promotes SlDML2 mRNA decay, thereby affecting DNA methylation and fruit ripening

Article Snippet: In brief, genomic DNA was extracted from the agroinfiltrated N. benthamiana leaves, and 500 ng of purified DNA was treated with bisulfite to produce mutations from cytosine (C) to thymine (T) using EZ DNA methylation-gold kit (ZYMO Research, D5005).

Techniques: CRISPR, Transgenic Assay, Sequencing, Liquid Chromatography with Mass Spectroscopy, Mutagenesis, Standard Deviation, Expressing, DNA Methylation Assay, Methylation, Modification

Journal: Genes & Development

Article Title: Break-induced replication promotes fragile telomere formation

doi: 10.1101/gad.328575.119

Figure Lengend Snippet: SLX1/SLX4 contribute to fragile telomere formation in Blm-deficient cells. (A) Western blot analysis of BLM in BlmF/F MEFs ± Cre (96 h). γ-Tubulin serves as the loading control. (B) Telomere FISH on metaphase spreads of BlmF/F MEFs ± Cre (96 h) with Cy3-[CCCTAA]3 probes (green) and DAPI staining (red). Fragile telomeres are marked by an asterisk. (C) Knockdown of ZRANB3, SMARCAL1, and HTLF with shRNAs (6 d) in BlmF/F MEFs verified by Western blotting. Cells infected with an shRNA targeting Luciferase (shLuc) were used as the control. γ-Tubulin serves as the loading control and an asterisk marks a nonspecific band detected by the HLTF antibody. (D) Quantification of fragile telomeres detected by FISH (q arms only) in BlmF/F MEFs ± Cre (96 h) with shRNAs targeting Luc, ZRANB3, SMARCAL1, or HTLF as described in C. (E) Quantification of q arm fragile telomeres detected by FISH in BlmF/F MEFs ± Cre (96 h) after CRISPR/Cas9 targeting of Slx4 with three different sgRNAs. Control cells were infected with an sgRNA targeting Luciferase (sgLuc). The relative level of SLX4 mRNA normalized to GAPDH was determined by RT-qPCR and compared with the sgLuc sample (set to 100). (F) Western blot analysis of SLX1 after CRISPR/Cas9 targeting of Slx1 with three different sgRNAs. γ-Tubulin serves as the loading control. (G) Quantification of q arm fragile telomeres detected by FISH in BlmF/F MEFs ± Cre (96 h) after CRISPR/Cas9 targeting of Slx1 with three different sgRNAs as in F. (H) Western blot analysis of the expression of FLAG-SLX4 and various mutants in BlmF/F MEFs with γ-Tubulin as the loading control. (I) Quantification of q arm fragile telomeres detected by FISH in BlmF/F MEFs + Cre (96 h) expressing empty vector (−), sgRNA-resistant WT FLAG-SLX4 or various mutants with CRISPR/Cas9 targeting of Luc or Slx4. (J) PLA foci (red) of TRF1 and γH2AX detected in BlmF/F MEFs ± Cre (96 h). (K) Quantification of PLA foci as in J in BlmF/F MEFs ± Cre (96 h) with CRISPR/Cas9 targeting of Luc, Slx4, or Slx1. Data are means ± SD of four independent experiments of >100 nuclei each. P-values were from paired two-tailed t-tests. (*) P ≤ 0.05. (L) PLA foci (red) of FLAG-TRF1 and 53BP1 detected in BlmF/F MEFs ± Cre (96 h). (M) Quantification of FLAG-TRF1/53BP1 PLA foci in BlmF/F MEFs ± Cre (96 h) with CRISPR/Cas9 targeting of Luc, Slx4, or Slx1. Data are means ± SD of three independent experiments of >100 nuclei each. For the fragile telomere analyses in D, E, G, and I, data are means ± SD from three independent experiments with ∼2000 telomeres analyzed per experiment. All P-values except for the ones in K were derived from unpaired two-tailed t-tests. (***) P ≤ 0.001, (**) P ≤ 0.01, (*) P ≤ 0.05, (n.s.) P > 0.05.

Article Snippet: Mouse Slx4 and Slx1 cDNAs were purchased from Origene and cloned into pWZL-FLAG-Hygro vector. sgRNA-resistant Slx4 (ATCTGAAACAATGCGCCGTC in place of sgRNA#2 ACTTGAAGCAGTGTGCGGTG) and Slx1 (CGGAAAAAGGGAGGTGCCTGG in place of sgRNA#1 GCAAGAAAGGTGGAGCATGG) were generated by site-directed mutagenesis using PCR.

Techniques: Western Blot, Staining, Infection, shRNA, Luciferase, CRISPR, Quantitative RT-PCR, Expressing, Plasmid Preparation, Two Tailed Test, Derivative Assay

Journal: Genes & Development

Article Title: Break-induced replication promotes fragile telomere formation

doi: 10.1101/gad.328575.119

Figure Lengend Snippet: Fragile telomeres of Blm-deficient cells arise from conservative replication. (A) Model for BIR-mediated fragile telomere formation and their removal after CO-FISH. (B) Schematic and images of CO-FISH on cells cultured in the presence of BrdU and BrdC for 16 or 26 h. The substituted DNA strands are removed by treatment with Hoechst 33258, UV, and exonuclease III. Telomeres replicated by leading-strand DNA synthesis were hybridized [TTAGGG]3 (green) and lagging-strand telomeres with [CCCTAA]3 (red). Cells labeled for 16 h (one S phase) show two signals per chromosome end, whereas cells labeled for 26 h (two S phases) show one signal per chromosome end, indicating that telomeres lacking a parental strand are poorly detected by CO-FISH. (C) Comparison of telomere FISH and CO-FISH performed on parallel metaphase spreads of BlmF/F MEFs + Cre (96 h). FISH was performed with [CCCTAA]3 (green), CO-FISH was done with [TTAGGG]3 (green) and [CCCTAA]3 (red), and DNA was stained with DAPI (blue). Fragile telomeres are marked by an asterisk. (D) Quantification of q arm fragile telomeres in BlmF/F ± Cre cells (96 h) detected by FISH and CO-FISH on the same samples derived from BrdU/BrdC-labeled cells. (E) Quantification of leading- and lagging-end q arm telomeres using CO-FISH as in D. Note that a sample with 6% lagging fragile telomeres and 2% leading fragile telomeres will show an average of 4% fragile telomeres when both sisters are scored (as is the case in D). (F) Quantification of leading- and lagging-end q arm fragile telomeres using CO-FISH in BlmF/F MEFs ± Cre (96 h) with CRISPR/Cas9 targeting of Luc, Slx4, or Slx1. (G) Quantification of leading- and lagging-end q arm fragile telomeres using CO-FISH in BlmF/F MEFs ± Cre (96 h) with shRNAs targeting Luc or Pold3. For all fragile telomere analyses in this figure, data are means ± SD of three independent experiments of ∼2000 telomeres analyzed per experiment. All P-values in this figure were derived from two-tailed unpaired t-test. (***) P ≤ 0.001, (**) P ≤ 0.01, (n.s.) P > 0.05.

Article Snippet: Mouse Slx4 and Slx1 cDNAs were purchased from Origene and cloned into pWZL-FLAG-Hygro vector. sgRNA-resistant Slx4 (ATCTGAAACAATGCGCCGTC in place of sgRNA#2 ACTTGAAGCAGTGTGCGGTG) and Slx1 (CGGAAAAAGGGAGGTGCCTGG in place of sgRNA#1 GCAAGAAAGGTGGAGCATGG) were generated by site-directed mutagenesis using PCR.

Techniques: Cell Culture, DNA Synthesis, Labeling, Comparison, Staining, Derivative Assay, CRISPR, Two Tailed Test

Journal: eLife

Article Title: Identification of a weight loss-associated causal eQTL in MTIF3 and the effects of MTIF3 deficiency on human adipocyte function

doi: 10.7554/eLife.84168

Figure Lengend Snippet: ( A ) Violin plot of MTIF3 expression in subcutaneous adipose tissue for rs1885988 from Genotype-Tissue Expression (GTEx) Project eQTL. ( B ) Same as in ( A ), but for rs67785913. ( C ) Representative Sanger sequencing traces of rs67785913 CTCT/CTCT and CT/CT clones obtained after CRISPR/Cas9-mediated allele editing and single-cell cloning. ( D ) Normalized Z -score plot of luciferase reporter assays using vectors carrying different DNA fragments of the MTIF3 gene cloned into pGL4.23 luciferase reporter vector. Hypothesis testing was performed by comparing the transcriptional enhancer activity of each of the 12 vectors (F1–12) to the empty vector (minP). All data were plotted as mean ± standard deviation (SD), n = 4 independent experiments, p values are presented in each graph; ordinary one-way analysis of variance (ANOVA) was used for statistical analysis. ( E ) Relative MTIF3 expression (mRNA) in rs67785913 allele-edited cells 2 days before, at, or 2 days post-differentiation induction (day −2, 0, and 2, respectively). n = 3 clonal populations for CTCT/CTCT genotype, n = 5 clonal populations for CT/CT genotype, error bars show SD. ( F ) as in ( E ), but for GTF3A (mRNA) expression. Two-tailed Student’s t -test was used; p values are presented in each graph.

Article Snippet: Sequence-based reagent , Taqman assay for GTF3A , Thermo Fisher Scientific , Hs00157851_m1 , .

Techniques: Expressing, Sequencing, Clone Assay, CRISPR, Cloning, Luciferase, Plasmid Preparation, Activity Assay, Standard Deviation, Two Tailed Test

Journal: eLife

Article Title: Identification of a weight loss-associated causal eQTL in MTIF3 and the effects of MTIF3 deficiency on human adipocyte function

doi: 10.7554/eLife.84168

Figure Lengend Snippet:

Article Snippet: Sequence-based reagent , Taqman assay for GTF3A , Thermo Fisher Scientific , Hs00157851_m1 , .

Techniques: Recombinant, Plasmid Preparation, Sequencing, TaqMan Assay, DNA Extraction, Isolation, Sample Prep, Picogreen Assay

Journal: Frontiers in Plant Science

Article Title: CRISPR-Cas9: Tool for Qualitative and Quantitative Plant Genome Editing

doi: 10.3389/fpls.2016.01740

Figure Lengend Snippet: Specific commercial products and services available to the researchers to implement CRISPR technology.

Article Snippet: Integrated DNA technologies (IDT) , Human HPRT PCR Primer Mix, Mouse HPRT PCR Primer Mix, Nuclease Free Duplex Buffer , S.p. Cas9 Expression Plasmid , S.p. Cas9 Nuclease 3NLS (100, 500 μg) , CRISPR Negative Control crRNA, CRISPR Positive Control crRNA.

Techniques: CRISPR, Genome Wide, Clone Assay, Stable Transfection, Selection, Transfection, Plasmid Preparation, Mutagenesis, Expressing, Negative Control, Positive Control, Construct, Knock-In, Multiplex Assay, Amplification, Sequencing

Journal: bioRxiv

Article Title: Invasion of glioma cells through confined space requires membrane tension regulation and mechano-electrical coupling via Plexin-B2

doi: 10.1101/2024.01.02.573660

Figure Lengend Snippet: (A) Schematic of CRISPR/Cas9-mediated PLXNB2 knockout (KO) with small guide (sg) RNA targeting second coding exon. (B) Western blots show Plexin-B2 expression in different SD2 GSCs, with β-actin as loading control. Note Plexin-B2 precursor at 240 kDa and mature form at 170 kDa. (C) IF images show Plexin-B2 expression in different SD2 GSCs, with Hoechst nuclear counterstain. (D) Left, schematic of atomic force microscopy (AFM) indentation method to probe cell stiffness by cantilever deflection. Middle, AFM indentation curves of different SD2 GSCs; right, box plots of cell stiffness, showing 25– 75% quartiles, median (line), and mean (plus sign). n= 6 cells per group. Kruskal–Wallis test followed by Dunn’s multiple comparisons test. (E) Left, depiction of membrane tension measurement with optical tweezers. Middle, force measurements during tether extrusion (shaded box). Right, quantifications of tether extrusion forces. n=5 cells per group. Kruskal–Wallis test followed by Dunn’s multiple comparisons test. (F) Left, schematic of FLIM of cell membranes labeled with Flipper-TR membrane dye, with low and high membrane tension associated with shorter and longer lifetimes, respectively. Middle top, representative FLIM images, with lifetime heatmap shown on right. Middle bottom, images show similar fluorescence intensities of Flipper-TR dye in WT and PB2 KO cells. Right top, violin plots show fluorescence lifetime from 3 images per group. Two-sided unpaired t-test. Right bottom, phasor plots of FLIM image data, with arrow indicating a shift to shorter lifetime values for PB2 KO cells. (G) Model of Plexin-B2 regulation of cortical contractility and membrane tension. Phalloidin staining show differences of F-actin network in WT and PB2 KO SD2 GSCs. DAPI for nuclear staining. Arrows point to stress fibers and spread-out contours of the WT GSCs.

Article Snippet: The lentiviral vector for Dox-inducible Plexin-B2 overexpression was generated by inserting human PLXNB2 cDNA into a Dox controlled expression vector (pLenti-CMVtight-PLXNB2 iOE; deposited as Addgene #176849) .

Techniques: CRISPR, Knock-Out, Western Blot, Expressing, Control, Microscopy, Membrane, Labeling, Fluorescence, Staining

Journal: bioRxiv

Article Title: Invasion of glioma cells through confined space requires membrane tension regulation and mechano-electrical coupling via Plexin-B2

doi: 10.1101/2024.01.02.573660

Figure Lengend Snippet: (A) Top, timeline for dextran uptake assay. Bottom, live-cell imaging of WT and PB2 KO SD2 GSCs labeled with SPY-Actin and exposed to dextran-Alexa488. Enlarged images of boxed areas are shown below. Quantification of the areas of dextran + clusters per cell are shown in box plots, with 25–75% quartiles, median (line), and mean (plus sign). n=85 cells for WT, n=44 cells for PB2 KO. Mann–Whitney–Wilcoxon test. (B) Top, live cell confocal plane images of WT and PB2 KO GSCs with side views of z-stacks showing intracellular localization of diffuse dextran-Alexa 488 signals in PB2 KO cells in addition to dextran endosome signals. In contrast, WT cells contained only dextran + endosomes. Bottom, histograms show fluorescence profiles showing bimodal distribution of dextran-Alexa 488 fluorescence intensities in PB2 KO GSCs (blue and brown arrows). n=177 cells for WT, n=161 cells for PB2 KO. Mann–Whitney–Wilcoxon test. (C, D) Left, schematic of myr-palm-GFP or -CFP attached to inner membrane leaflet. Right, live cell fluorescence imaging at 72 hr after transfection shows internalization of myr-palm-GFP or -CPF on endomembranes (arrow) in WT GSCs, in contrast to membrane retention of the probes (arrowhead) in PB2 KO GSCs. (E) Left, schematic of TauSTED super-resolution microscopy of GSCs labeled with MemGlow. Middle, TauSTED live-cell images show reduced endosomes (arrowheads) in PB2 KO cells compared to WT. Right, box plots show areas of MemGlow clusters in each cell. n=26 cells for WT, n=13 cells for PB2 KO. Two-sided unpaired t-test. (F) Working model of regulation of cortical and membrane tension by Plexin-B2, affecting endocytosis and membrane permeability in GSCs.

Article Snippet: The lentiviral vector for Dox-inducible Plexin-B2 overexpression was generated by inserting human PLXNB2 cDNA into a Dox controlled expression vector (pLenti-CMVtight-PLXNB2 iOE; deposited as Addgene #176849) .

Techniques: Live Cell Imaging, Labeling, MANN-WHITNEY, Fluorescence, Membrane, Imaging, Transfection, Super-Resolution Microscopy, Permeability

Journal: bioRxiv

Article Title: Invasion of glioma cells through confined space requires membrane tension regulation and mechano-electrical coupling via Plexin-B2

doi: 10.1101/2024.01.02.573660

Figure Lengend Snippet: (A) Left, schematic of PH(PLCδ1)-GFP PIP2 probe. Right, live-cell imaging at 72 hr post transfection reveals that the PH(PLCδ1)-GFP probes were largely internalized in WT GSCs (arrow), but retained on membrane of PB2 KO GSCs (arrowhead). (B) Left, still images of videography show accumulation of the PH(PLCδ1)-GFP probes (arrow) in front of the nucleus (NucSpot) of migrating WT SD2 GSCs in tunnels, more so in 3 than 8 µm tunnel, but not in PB2 KO cells. Dashed lines delineate cell boundary. Long arrow denotes direction of migration. Right, quantifications of the ratio of PH(PLCδ1)-GFP fluorescence intensity at front vs. rear of GSCs during passage. n=13-16 cells per condition. One-way ANOVA followed by Tukey’s multiple comparison test. Data represent mean ± SEM. (C) Left, schematic of R(+8)-pre-GFP probe for negative surface charge of inner plasma membrane. Right, live-cell imaging at 72 hr post-transfection shows internalization of the probes (arrow) in WT GSCs, in contrast to the predominant membrane localization in PB2 KO GSCs (arrowhead). (D) Left, still images of videography show accumulation of the R(+8)-pre-GFP probes (arrow) at front zone of WT GSCs when traversing the 3 µm tunnel, but not in PB2 KO cells. Right, bar graphs show the ratio of R-pre-GFP fluorescence intensity at rear vs. front of GSCs when passing through tunnels. n=22 cells for WT, n=27 cells for PB2 KO. Mann–Whitney–Wilcoxon test. Data represent mean ± SEM. (E) Diagram illustrating voltage sensitive FluoVolt membrane dye, with fluorescent intensity quenched by voltage-sensitive electron transfer from electron-rich donor mediated by “molecular wire” in plasma membrane. (F) Left, FluoVolt live-cell imaging shows reduced FluoVolt fluorescent intensity in cell membrane of Plexin-B2 KO cells, consistent with higher negative charges of inner membrane. Right, box plots of membrane FluoVolt intensity. n=25 cells for WT, n=27 cells for PB2 KO. Two-sided unpaired t-test. Data represent mean ± SEM. (G) Left, still images from videography show higher FluoVolt fluorescent signals at rear zone (arrowhead) of WT GSCs when traversing tunnels, more so in 3 than 8 µm tunnel, but not in PB2 KO cells. Migration direction is denoted by long arrow. Right, bar graphs show the ratio of FluoVolt intensity at rear vs. front during confined migration. n=15 cells per group. One-way ANOVA followed by Tukey’s multiple comparison test. Data represent mean ± SEM. (H) Live-cell images and quantifications show the effects of constitutive active (CA) RAP1B-V12 or dominant-negative (DN) RAP1B-N17 on FluoVolt intensity in WT or PB2 KO GSCs. n=25 cells per group. Kruskal–Wallis test followed by Dunn’s multiple comparisons test. (I) Left, still images capture calcium localization (Fluo4-AM fluorescence, arrowhead) at the rear of WT GSCs when traversing tunnels, more so in 3 than 8 µm tunnel, but not in PB2 KO cells. Migration direction is denoted by long arrow. Right, bar graphs showing Fluo4-AM intensity ratio at rear vs. front in GSC during passage through tunnels. n=15-16 cells. One-way ANOVA followed by Tukey’s multiple comparison test. Data represent mean ± SEM. (J) Left, still images from videography show that calcium chelator BAPTA-AM disrupted the pattern of high FluoVolt signals at the rear of WT GSCs (arrowhead) during confined migration. Right, bar graphs show FluoVolt intensity ratio at rear vs. front of GSCs when traversing tunnels. n=21 cells for WT, n=16 cells for PB2 KO. Two-sided unpaired t-test. Data represent mean ± SEM. (K) Model of Plexin-B2 signaling affecting membrane surface charge and electric field during polarized confined migration, with PIP2 enrichment at cell front and Ca 2+ at rear zone, leading to asymmetry of FluoVolt and R(+8)-pre-GFP.

Article Snippet: The lentiviral vector for Dox-inducible Plexin-B2 overexpression was generated by inserting human PLXNB2 cDNA into a Dox controlled expression vector (pLenti-CMVtight-PLXNB2 iOE; deposited as Addgene #176849) .

Techniques: Live Cell Imaging, Transfection, Membrane, Migration, Fluorescence, Comparison, Clinical Proteomics, MANN-WHITNEY, Dominant Negative Mutation

Journal: bioRxiv

Article Title: Invasion of glioma cells through confined space requires membrane tension regulation and mechano-electrical coupling via Plexin-B2

doi: 10.1101/2024.01.02.573660

Figure Lengend Snippet: (A) Structure model of the extracellular domain of human Plexin-B2 show the locations of lock1 and lock2 mutations predicted to form disulfide bridges that lock the ring structure. (B) Western blots show absence of mature Plexin-B2 (170 kDa) in PB2 KO GSC, and expression of lock mutants in PB2 KO SD2 and SD3 GSCs. β-actin serves as a loading control. (C) Still images from videography show passage of GSCs (nuclei visualized by NucSpot) through microchannels with PB2 wildtype rescue construct but not lock mutants, nor PB2 with deletion of extracellular domain (dECTO). Chevrons point to 3 µm constrictions. (D) Box plots show velocity through constrictions, stalling time at constrictions, and sum of forward and backward movements, with 25–75% quartiles, minimal and maximal values (whiskers), median (line), and mean (cross). For velocity and sum of movements: n=17-20 cells per condition. For stalling time at constriction: n=14-28 cells per condition. One-way ANOVA followed by Dunnett’s multiple comparisons test. (E) Still images from videography show F-actin assembly (SPY-actin, arrowhead) at cell rear and MemGlow + endosomes (arrow) at cell front of SD3 GSCs with Plexin-B2 WT rescue but not mutant rescues when traversing 3 µm constrictions (chevrons). (F) Bar graphs showing fluorescence intensity ratio of SPY-actin and MemGlow at rear vs. front of GSCs during confined migration. n=10-18 cells per condition. Kruskal–Wallis test followed by Dunn’s multiple comparisons test. Data represent mean ± SEM. (G) Model of Plexin-B2 signaling and mechano-electrical regulation of membrane tension and membrane surface charge during polarized confined migration. Regionalized enrichment of endocytosis/PIP2 at cell front and F-actin/Ca 2+ at rear zone lead to asymmetry of FluoVolt and R(+8)-pre-GFP membrane probes.

Article Snippet: The lentiviral vector for Dox-inducible Plexin-B2 overexpression was generated by inserting human PLXNB2 cDNA into a Dox controlled expression vector (pLenti-CMVtight-PLXNB2 iOE; deposited as Addgene #176849) .

Techniques: Western Blot, Expressing, Control, Construct, Mutagenesis, Fluorescence, Migration, Membrane